Primer3 Input -version 0.4.0- May 2026
PRIMER_MAX_MISPRIMING=12.0 PRIMER_MAX_END_MISPRIMING=6.0 PRIMER_NUM_RETURN=5 Running Primer3 v0.4.0 Save your input as input.txt . Then run:
The basic structure looks like this:
PRIMER_SEQUENCE_ID=my_amplicon SEQUENCE=ATCGGCTAGCTAGCTCGATCGATCGATCGATGCGCTAGC PRIMER_TASK=pick_detection_primers = While many parameters are inherited from earlier versions, version 0.4.0 introduced refined control over mispriming libraries and output formatting. 1. Defining Your Sequence You must provide the target sequence. Use SEQUENCE for the template. For internal oligos (e.g., hybridization probes), use SEQUENCE_INTERNAL . primer3 input -version 0.4.0-
PRIMER_INTERNAL_OPT_SIZE=20 PRIMER_INTERNAL_MIN_SIZE=18 PRIMER_INTERNAL_MAX_SIZE=30 PRIMER_INTERNAL_OPT_TM=65.0 # Probe Tm should be 5-8°C higher than primers PRIMER_INTERNAL_MIN_TM=63.0 PRIMER_INTERNAL_MAX_TM=68.0 Here is a real-world input for amplifying a 200 bp region from a bacterial 16S rRNA gene: PRIMER_MAX_MISPRIMING=12
PRIMER_PICK_LEFT_INPUT=1 # Start of left primer search region PRIMER_PICK_RIGHT_INPUT=500 # End of right primer search region To force primers to flank a specific SNP or target: Defining Your Sequence You must provide the target sequence